VISA: RAG with Visual Source Attribution
Collection
8 items
•
Updated
•
3
image
imagewidth (px) 392
842
| id
stringlengths 19
20
| long_answer_type
stringclasses 1
value | question
stringlengths 13
334
| short_answer
stringlengths 1
677
| candidates
sequencelengths 0
3
| pos_idx
int64 -1
2
| bounding_box
sequencelengths 4
4
|
|---|---|---|---|---|---|---|---|
PMC5750536_00004.jpg
|
text
|
What is the significance level of the increase in Qmax mL/s in the treatment group?
|
p < 0.001
|
[
"PMC5750536_00004.jpg",
"PMC3279134_00007.jpg",
"PMC4937636_00005.jpg"
] | 0 |
[
76,
326,
518,
381
] |
|
PMC5770511_00005.jpg
|
text
|
What is the lowest LODs that can be achieved using ICP-IES?
|
0.17 ng·mL-1
|
[
"PMC4768234_00006.jpg",
"PMC5087850_00024.jpg",
"PMC3979282_00006.jpg"
] | -1 |
[
306,
57,
544,
230
] |
|
PMC4766352_00005.jpg
|
text
|
What is the age of diagnosis for the individual carrying both the p.I27L and the p.S487N polymorphism?
|
19 years of age
|
[
"PMC4369133_00004.jpg",
"PMC4766352_00005.jpg",
"PMC4684709_00017.jpg"
] | 1 |
[
308,
365,
548,
549
] |
|
PMC4857728_00006.jpg
|
text
|
What is the main finding of the study?
|
Heparan sulfate sulfotransferases are differentially expressed in anterior and posterior blastema cells during regeneration.
|
[] | -1 |
[
310,
641,
537,
688
] |
|
PMC4786076_00001.jpg
|
text
|
How many Chinese older adults aged 60 years and older were there in the U.S. in 2010?
|
538,417
|
[
"PMC4530267_00000.jpg",
"PMC5008847_00007.jpg",
"PMC4786076_00002.jpg"
] | -1 |
[
150,
487,
523,
582
] |
|
PMC4989451_00008.jpg
|
text
|
What is the relationship between the abundance of chloroplastic ribosomal proteins and cytoplasmic ribosomal proteins under N limitation?
|
The abundance of chloroplastic ribosomal proteins is greater than that of cytoplasmic ribosomal proteins under N limitation.
|
[
"PMC4989451_00008.jpg",
"PMC3838199_00004.jpg",
"PMC5897788_00009.jpg"
] | 0 |
[
58,
455,
286,
657
] |
|
PMC5678687_00001.jpg
|
text
|
What is the frequency of CTNNB1 mutations in sporadic desmoid tumors?
|
85%
|
[
"PMC3615633_00003.jpg",
"PMC5678687_00001.jpg",
"PMC5624685_00003.jpg"
] | 1 |
[
294,
641,
546,
686
] |
|
PMC3080807_00007.jpg
|
text
|
What was the result of the genetic testing performed on the mother of the patient?
|
She was not a carrier of the disease-causing mutation.
|
[
"PMC3523596_00001.jpg",
"PMC3932290_00001.jpg",
"PMC3932282_00001.jpg"
] | -1 |
[
56,
644,
290,
727
] |
|
PMC4657225_00000.jpg
|
text
|
What is the most noticeable feature of Sturge-Weber Syndrome?
|
The nevus flammeus
|
[
"PMC4090536_00003.jpg",
"PMC4254265_00005.jpg",
"PMC5735576_00003.jpg"
] | -1 |
[
56,
438,
290,
569
] |
|
PMC5967883_00000.jpg
|
text
|
What is the main focus of the studies mentioned in the introduction?
|
The main focus of the studies is to identify an obesity phenotype that is not accompanied by a clustering of adiposity-associated cardio-metabolic risk factors.
|
[] | -1 |
[
55,
563,
298,
717
] |
|
PMC5504222_00002.jpg
|
text
|
What is the purpose of the statistical analyses mentioned in the text?
|
To test the normality and homogeneity of the variances.
|
[] | -1 |
[
306,
381,
544,
429
] |
|
PMC4590518_00001.jpg
|
text
|
What is the baseline hazard?
|
The baseline hazard is stratified by sex.
|
[
"PMC5440083_00012.jpg",
"PMC4590518_00001.jpg",
"PMC4796396_00002.jpg"
] | 1 |
[
304,
546,
540,
664
] |
|
PMC4882829_00002.jpg
|
text
|
What is the primary aim of the research?
|
To evaluate whether use of rigid WHO over 3 years in children with CP combined with usual multidisciplinary care can prevent or reduce musculoskeletal impairment including loss of range of movement and muscle stiffness at the wrist, compared to usual multidisciplinary care alone.
|
[] | -1 |
[
304,
86,
538,
265
] |
|
PMC3224249_00000.jpg
|
text
|
What is the main goal of acute psychiatric in-patient units for adolescents?
|
To effectively meet important needs for young people with suicidal risks or other severe mental health problems.
|
[
"PMC3224249_00000.jpg",
"PMC3851239_00000.jpg",
"PMC5357256_00000.jpg"
] | 0 |
[
63,
513,
528,
560
] |
|
PMC6060453_00001.jpg
|
text
|
What is the purpose of the experiment described in the red bounding box?
|
To compare the genomic stability of ci-iPSCs and lv-iPSCs.
|
[] | -1 |
[
56,
86,
292,
209
] |
|
PMC5733958_00000.jpg
|
text
|
What is the main topic of the case report?
|
Primary cytomegalovirus infection causing Guillain-Barré syndrome in a living renal allograft recipient.
|
[
"PMC5733958_00000.jpg",
"PMC6020506_00000.jpg",
"PMC2253541_00000.jpg"
] | 0 |
[
86,
376,
548,
419
] |
|
PMC4950144_00003.jpg
|
text
|
What is the main topic of the text in the red bounding box?
|
The importance of early vigour in plant development.
|
[] | -1 |
[
63,
89,
290,
335
] |
|
PMC2970581_00002.jpg
|
text
|
What is the purpose of the comparison shown in Figure 1?
|
To compare the dispersion of non-dispersed and Surfactant-dispersed SWCNTs.
|
[] | -1 |
[
62,
633,
532,
702
] |
|
PMC5846977_00001.jpg
|
text
|
What is the legacy hypothesis?
|
The legacy hypothesis implies that having children increases concern about the environment and climate change as a result of parents considering the legacy left to offspring in respect of environmental quality.
|
[
"PMC5846977_00001.jpg",
"PMC5094182_00001.jpg",
"PMC5701757_00002.jpg"
] | 0 |
[
50,
332,
388,
439
] |
|
PMC5838147_00011.jpg
|
text
|
What is the effect of shielding on the properties of molecules?
|
Shielding can lead to significant improvement in permeability and oral bioavailability.
|
[
"PMC5838147_00011.jpg",
"PMC4887198_00029.jpg",
"PMC4685921_00002.jpg"
] | 0 |
[
306,
79,
546,
506
] |
|
PMC3474953_00004.jpg
|
text
|
What is the relationship between erythrocyte deformability and the surface-volume ratio?
|
Erythrocyte deformability physiologically depends on the surface-volume ratio.
|
[
"PMC4999027_00002.jpg",
"PMC2694807_00006.jpg",
"PMC3474953_00004.jpg"
] | 2 |
[
63,
320,
311,
399
] |
|
PMC5433534_00007.jpg
|
text
|
How many young people were interested in taking part in the study?
|
4
|
[
"PMC5433534_00007.jpg",
"PMC4983064_00005.jpg",
"PMC4353820_00001.jpg"
] | 0 |
[
104,
448,
311,
574
] |
|
PMC4950194_00003.jpg
|
text
|
What is the relationship between stress time and the number of defects in the map?
|
With increasing stress time, the number of defects in the map increases.
|
[
"PMC4950194_00003.jpg",
"PMC4655867_00004.jpg",
"PMC5638101_00004.jpg"
] | 0 |
[
55,
452,
438,
490
] |
|
PMC3781608_00000.jpg
|
text
|
How many cases had a serum ferritin level <15 ng/mL and were diagnosed as IDA?
|
3
|
[
"PMC3972954_00000.jpg",
"PMC5854719_00005.jpg",
"PMC3781608_00000.jpg"
] | 2 |
[
311,
252,
569,
358
] |
|
PMC4726714_00006.jpg
|
text
|
What are the two vaccines that were included in groups V and VI?
|
North China Pharmaceutical and GlaxoSmithKline
|
[
"PMC4726714_00006.jpg",
"PMC3758929_00004.jpg",
"PMC5707880_00003.jpg"
] | 0 |
[
51,
339,
289,
374
] |
|
PMC5516236_00008.jpg
|
text
|
What does the state need to consider when externalities arise?
|
The state needs to consider how to reallocate these gains and costs through taxation and subsidies when externalities arise.
|
[
"PMC6013539_00008.jpg",
"PMC4708618_00008.jpg",
"PMC5516236_00008.jpg"
] | 2 |
[
298,
675,
526,
696
] |
|
PMC3557956_00003.jpg
|
text
|
What is the purpose of the APEIR study?
|
To measure the impact of poultry production policies on the risk of infection and spread of disease, including humans.
|
[
"PMC3557909_00002.jpg",
"PMC5876343_00005.jpg",
"PMC3395192_00001.jpg"
] | -1 |
[
65,
179,
277,
380
] |
|
PMC5437633_00001.jpg
|
text
|
What are the two evolutionary forces that drive the fate determination processes of non-coding DNA elements?
|
Conservation and/or deterioration of DNA structural elements
|
[] | -1 |
[
56,
242,
290,
457
] |
|
PMC4353458_00002.jpg
|
text
|
What is the primary objective of the study?
|
To determine whether TTM between 32.5°C and 33.5°C for 24 hours improves day-90 neurological outcomes compared to TTM between 36.5°C and 37.5°C in survivors of nonshockable cardiac arrest.
|
[
"PMC5199189_00002.jpg",
"PMC5575720_00000.jpg",
"PMC5496240_00001.jpg"
] | -1 |
[
304,
100,
538,
135
] |
|
PMC5771425_00010.jpg
|
text
|
How long should the medium be removed from the flasks/dishes?
|
1 hour
|
[
"PMC5771425_00010.jpg",
"PMC5766641_00006.jpg",
"PMC5951408_00013.jpg"
] | 0 |
[
150,
447,
514,
487
] |
|
PMC3490377_00006.jpg
|
text
|
What is the reference for the original synthesis of the OT antagonist?
|
46, 130
|
[
"PMC5994413_00003.jpg",
"PMC5381755_00000.jpg",
"PMC3596952_00006.jpg"
] | -1 |
[
304,
663,
543,
731
] |
|
PMC3022213_00001.jpg
|
text
|
What is the purpose of the immunohistochemical localization of iNOS, TNF-α, IL-1β, ICAM-1, Nitrotyrosine, PAR, Bax, and Bel-2?
|
To study the effects of the compound on an acute lesion.
|
[] | -1 |
[
308,
527,
548,
742
] |
|
PMC4962323_00007.jpg
|
text
|
What is the purpose of the family disadvantage index?
|
To reflect the family's situation when the young people were 12 years old.
|
[
"PMC5597683_00004.jpg",
"PMC4858843_00001.jpg",
"PMC4962323_00007.jpg"
] | 2 |
[
48,
181,
392,
300
] |
|
PMC4830888_00001.jpg
|
text
|
What is the main focus of the section on the anatomy of the heart?
|
To help readers establish a better association between the outcomes of various functional analysis methods and the actual structure of the heart.
|
[
"PMC4959513_00008.jpg",
"PMC5820407_00001.jpg",
"PMC4830888_00001.jpg"
] | 2 |
[
306,
581,
546,
717
] |
|
PMC4096626_00024.jpg
|
text
|
What is the purpose of the study mentioned in the red bounding box?
|
To measure immunoreactivity to trophic factors and cytokines in CSF samples from patients with clinically diagnosed probable AD.
|
[] | -1 |
[
78,
488,
511,
526
] |
|
PMC4762933_00019.jpg
|
text
|
What is the evidence for involvement of abnormalities in the amygdala in ODD/CD?
|
Strong
|
[
"PMC2825652_00002.jpg",
"PMC5360847_00004.jpg",
"PMC4762933_00019.jpg"
] | 2 |
[
306,
344,
544,
716
] |
|
PMC5951165_00000.jpg
|
text
|
Who are the authors of the article?
|
Hong-Xiang Liu, Prasangi Rajapaksha, Zhongzhou Wang, Naomi E Kramer, and Brett J Marshall
|
[] | -1 |
[
90,
178,
500,
204
] |
|
PMC3526554_00004.jpg
|
text
|
What was the economic loss for the patients in the study?
|
The patients did not suffer significant economic loss.
|
[
"PMC3526554_00004.jpg",
"PMC4323144_00002.jpg",
"PMC3945079_00005.jpg"
] | 0 |
[
304,
88,
538,
351
] |
|
PMC5637878_00007.jpg
|
text
|
What is the impact of increasing cropping intensity on SOC?
|
SOC is enhanced by increasing cropping intensity.
|
[
"PMC5637878_00007.jpg",
"PMC5937581_00003.jpg",
"PMC6001646_00001.jpg"
] | 0 |
[
37,
297,
288,
349
] |
|
PMC5052285_00003.jpg
|
text
|
What is the significance of the histological assessment of salivary gland neoplasms?
|
It requires specialist experience to avoid diagnostic traps.
|
[
"PMC5705891_00000.jpg",
"PMC5104792_00003.jpg",
"PMC5052285_00003.jpg"
] | 2 |
[
51,
548,
289,
707
] |
|
PMC5081062_00001.jpg
|
text
|
What is the purpose of the study mentioned in the text?
|
To identify medicinal plants used to treat respiratory live- stock diseases.
|
[] | -1 |
[
311,
203,
562,
255
] |
|
PMC4304283_00000.jpg
|
text
|
What is the evidence in favor of duty hour restrictions?
|
In some cases, led to changes without consideration of
|
[
"PMC4494302_00009.jpg",
"PMC5951142_00002.jpg",
"PMC5771429_00004.jpg"
] | -1 |
[
304,
481,
538,
600
] |
|
PMC5064797_00005.jpg
|
text
|
What is the main focus of the study?
|
The study focuses on the relationship between staffing and patient outcomes in nursing staff matters.
|
[] | -1 |
[
56,
614,
290,
733
] |
|
PMC5482710_00002.jpg
|
text
|
What is the purpose of the susceptibility weighted imaging (SWI) sequences?
|
To validate presence and localisation of CMBs.
|
[] | -1 |
[
150,
165,
523,
288
] |
|
PMC4744265_00008.jpg
|
text
|
What did participants do to distinguish between the possibilities?
|
They identified two targets (T1 and T2) embedded in multistream RSVP displays that occurred concurrently across lateral hemifields.
|
[] | -1 |
[
306,
57,
544,
280
] |
|
PMC5935453_00017.jpg
|
text
|
What is the standardized estimate for MOS-SFV?
|
0.079
|
[
"PMC5680378_00002.jpg",
"PMC5935453_00017.jpg",
"PMC5051604_00008.jpg"
] | 1 |
[
73,
83,
99,
678
] |
|
PMC5086478_00005.jpg
|
text
|
How many loci were identified in the genome-wide association study of intracerebral hemorrhage?
|
148
|
[
"PMC4879189_00005.jpg",
"PMC5086478_00005.jpg",
"PMC4317331_00003.jpg"
] | 1 |
[
306,
668,
544,
716
] |
|
PMC5559757_00007.jpg
|
text
|
What is the second completely different factor mentioned in the text?
|
The occurrence of physical symptoms
|
[] | -1 |
[
305,
63,
550,
129
] |
|
PMC4437336_00004.jpg
|
text
|
What is the p-value for the difference in fasting insulinemia between groups A and B at baseline?
|
.001
|
[
"PMC4437336_00004.jpg",
"PMC4529466_00005.jpg",
"PMC2982198_00003.jpg"
] | 0 |
[
50,
80,
548,
103
] |
|
PMC2561033_00001.jpg
|
text
|
What is the role of psychologists at distant and sequestered detention centers?
|
PENS describes a clearly delineated role for psychologists at distant and sequestered detention centers.
|
[
"PMC5809830_00017.jpg",
"PMC5053369_00006.jpg",
"PMC4986270_00001.jpg"
] | -1 |
[
55,
213,
296,
319
] |
|
PMC5016536_00006.jpg
|
text
|
What is the purpose of tracking down both genetical lines in the context of MRTs?
|
To identify both the donor's and mother's genetical lines.
|
[
"PMC5903588_00003.jpg",
"PMC5016536_00006.jpg",
"PMC3504576_00005.jpg"
] | 1 |
[
51,
262,
388,
331
] |
|
PMC3693621_00002.jpg
|
text
|
How many months did the intervention last in the study by Amin et al. (2009)?
|
24 months
|
[
"PMC3808566_00004.jpg",
"PMC5899110_00008.jpg",
"PMC3693621_00002.jpg"
] | 2 |
[
89,
176,
98,
737
] |
|
PMC5100226_00004.jpg
|
text
|
What is the main reason for the increased awareness of breast cancer in the UAE?
|
Because they are a big awareness now in the country about the breast cancer.
|
[
"PMC5854275_00000.jpg",
"PMC5100226_00004.jpg",
"PMC5615477_00007.jpg"
] | 1 |
[
66,
146,
284,
193
] |
|
PMC5380570_00001.jpg
|
text
|
What was the location of the university research facility in Dresden, Germany?
|
Dresden, Germany
|
[] | -1 |
[
117,
484,
477,
537
] |
|
PMC5976263_00029.jpg
|
text
|
What is the origin of PCE?
|
The origin of PCE is somewhat controversial and not fully understood.
|
[
"PMC6069525_00021.jpg",
"PMC5976263_00029.jpg",
"PMC4735902_00002.jpg"
] | 1 |
[
150,
236,
522,
458
] |
|
PMC5724773_00013.jpg
|
text
|
What is the source of the data used in the figure?
|
CogEcon 2011
|
[] | -1 |
[
150,
445,
522,
540
] |
|
PMC2614190_00000.jpg
|
text
|
What is the main focus of the study?
|
The study focuses on the phylogenetic relationships among seven yeast species.
|
[] | -1 |
[
70,
623,
561,
651
] |
|
PMC2773533_00005.jpg
|
text
|
What were the trends for maternal supplementation during pregnancy with vitamins C, E, and A?
|
There were trends for maternal supplementation during pregnancy with vitamins C, E, and A to increase reported levels of those vitamins in SIDS infants, and for infant sup- plementation with Vitamin D to increase vitamin C levels in supplemented infants.
|
[
"PMC4265258_00004.jpg",
"PMC2773533_00005.jpg",
"PMC5758600_00006.jpg"
] | 1 |
[
48,
169,
290,
282
] |
|
PMC5729550_00001.jpg
|
text
|
What is the sequence of the primer for ALP?
|
F: CGAGATCAGCAGCTCCAGCTTC R: CTGTCAGCCTGCTATGCTGATC
|
[
"PMC4579027_00008.jpg",
"PMC5662279_00004.jpg",
"PMC5729550_00001.jpg"
] | 2 |
[
311,
496,
559,
681
] |
|
PMC4474479_00018.jpg
|
text
|
What were the cells pretreated with in the experiment?
|
50 µM quercetin, 1.25 µM terbinafine, 1.25 µM cefaclor, 1.25 µM doxepin, or 10 µM rolipram
|
[
"PMC4335501_00013.jpg",
"PMC5192441_00011.jpg",
"PMC3226551_00001.jpg"
] | -1 |
[
150,
61,
524,
184
] |
|
PMC5742667_00001.jpg
|
text
|
What is the purpose of enclosing the tubes in aluminum foil?
|
To avoid exposure to light
|
[] | -1 |
[
307,
430,
548,
517
] |
|
PMC5788004_00010.jpg
|
text
|
What is the layout of the nanostructures critical for?
|
Damage to the bacterial membrane
|
[
"PMC5494287_00001.jpg",
"PMC4584506_00002.jpg",
"PMC4373140_00000.jpg"
] | -1 |
[
33,
641,
284,
745
] |
|
PMC5424681_00004.jpg
|
text
|
What is the overall incidence of cancer in the study population?
|
12.5%
|
[] | -1 |
[
56,
650,
300,
796
] |
|
PMC5215386_00010.jpg
|
text
|
What is the significance of the indirect effect of narrative transportation on generating valuable improvement suggestions?
|
The indirect effect of narrative transportation on generating valuable improvement suggestions is significant with a point value of .136 and a 95% bias-corrected confidence interval [BCaCI] of .096 to .194.
|
[
"PMC4701054_00012.jpg",
"PMC4119717_00006.jpg",
"PMC5215386_00010.jpg"
] | 2 |
[
314,
515,
553,
729
] |
|
PMC5829835_00007.jpg
|
text
|
What is the leading cause of TBI-related death among those aged 0-4 years?
|
Assault/homicide
|
[
"PMC5701730_00024.jpg",
"PMC4977400_00015.jpg",
"PMC5829835_00007.jpg"
] | 2 |
[
318,
265,
578,
409
] |
|
PMC5267359_00001.jpg
|
text
|
What is the difference between complete and incomplete AVSDs?
|
In incomplete AVSDs, shunting is restricted to the atrial level via an ostium primum or primary atrial septal defect, while in complete AVSDs, an inlet-type ventricular septal defect is also found.
|
[
"PMC4377395_00005.jpg",
"PMC3263583_00001.jpg",
"PMC5027167_00002.jpg"
] | -1 |
[
150,
469,
524,
606
] |
|
PMC4579573_00001.jpg
|
text
|
Can MPN+ domain DUBs act in isolation?
|
Yes
|
[
"PMC5027583_00004.jpg",
"PMC4579573_00001.jpg",
"PMC3462321_00009.jpg"
] | 1 |
[
150,
661,
495,
686
] |
|
PMC6091187_00001.jpg
|
text
|
What is the concentration of glucose in the broth used for the overnight culture?
|
1%
|
[] | -1 |
[
304,
638,
538,
733
] |
|
PMC4543687_00009.jpg
|
text
|
What is the main focus of the research described in the figure?
|
The main focus of the research is to analyze the transcriptome signature in the adipose tissue from subjects with Cushing's disease.
|
[] | -1 |
[
56,
479,
297,
515
] |
|
PMC5388803_00003.jpg
|
text
|
What is the purpose of the study?
|
To obtain a comprehensive evaluation of the in vitro potency of OZ439 and OZ277.
|
[] | -1 |
[
41,
238,
370,
440
] |
|
PMC5674240_00002.jpg
|
text
|
How many cases of autoimmune encephalitis were there?
|
64
|
[
"PMC5530032_00006.jpg",
"PMC4528866_00002.jpg",
"PMC4971038_00004.jpg"
] | -1 |
[
56,
218,
290,
482
] |
|
PMC6000814_00003.jpg
|
text
|
What is the main difference between the treatment profiles for Hanta and Boro?
|
The treatment profiles for Hanta showed more correct choices for liver fluke than CBPP.
|
[
"PMC3366868_00006.jpg",
"PMC3862191_00004.jpg",
"PMC4912461_00018.jpg"
] | -1 |
[
306,
345,
557,
407
] |
|
PMC4222260_00000.jpg
|
text
|
What is the main focus of the research article?
|
The main focus of the research article is to investigate whether visual feedback during walking results in similar improvements in trunk control for young and older healthy adults.
|
[] | -1 |
[
63,
339,
530,
398
] |
|
PMC4078578_00002.jpg
|
text
|
What was the purpose of the comprehensive country questionnaire?
|
To monitor the implementation of the European Commitment to Act on climate change and health.
|
[
"PMC4078578_00003.jpg",
"PMC6014023_00007.jpg",
"PMC4078578_00002.jpg"
] | 2 |
[
72,
238,
545,
301
] |
|
PMC4899464_00001.jpg
|
text
|
What is the aim of this review?
|
To provide a comprehensive overview of the use of IRTs in animals.
|
[] | -1 |
[
304,
691,
549,
715
] |
|
PMC4168577_00004.jpg
|
text
|
What is the purpose of the family planning intervention?
|
To support improvements in newborn and child health
|
[
"PMC4168577_00004.jpg",
"PMC5725968_00005.jpg",
"PMC5712133_00001.jpg"
] | 0 |
[
113,
463,
315,
541
] |
|
PMC5637954_00008.jpg
|
text
|
What is the main focus of the study?
|
The study focuses on the formation of deformation structures in calcite.
|
[] | -1 |
[
172,
369,
575,
427
] |
|
PMC5887883_00005.jpg
|
text
|
What is the effect of maternal schooling on the proportion of gingival bleeding?
|
1.99 (1.53-2.60)
|
[
"PMC5478809_00006.jpg",
"PMC4710615_00006.jpg",
"PMC5887883_00005.jpg"
] | 2 |
[
307,
115,
550,
215
] |
|
PMC5798176_00002.jpg
|
text
|
What was the basis for the new BMI classification generated for the HIS?
|
The corrected BMI values
|
[
"PMC6091152_00002.jpg",
"PMC5568497_00001.jpg",
"PMC5459089_00007.jpg"
] | -1 |
[
304,
170,
538,
265
] |
|
PMC4661202_00001.jpg
|
text
|
When did NeXstar sell?
|
1997
|
[
"PMC5754929_00023.jpg",
"PMC5621764_00005.jpg",
"PMC4661202_00001.jpg"
] | 2 |
[
306,
345,
544,
504
] |
|
PMC5272871_00008.jpg
|
text
|
What is the fold increase in CCE occlusion found in glaucoma compared with normal eyes?
|
1.7-fold
|
[
"PMC5272871_00008.jpg",
"PMC5364610_00003.jpg",
"PMC4917694_00002.jpg"
] | 0 |
[
150,
61,
514,
100
] |
|
PMC5831892_00006.jpg
|
text
|
What is the purpose of the interventions presented in Table 2?
|
To provide informational support to those who terminate the pregnancy.
|
[
"PMC4318242_00013.jpg",
"PMC5598091_00006.jpg",
"PMC4812654_00006.jpg"
] | -1 |
[
117,
88,
477,
127
] |
|
PMC3016255_00000.jpg
|
text
|
What is the potential impact of the hypothesis on the development of vaccines?
|
The hypothesis could be valuable in developing early warning criteria to identify emerging egg-associated Salmonella strains and in developing safe live attenuated vaccine strains.
|
[
"PMC3475665_00002.jpg",
"PMC3016255_00000.jpg",
"PMC3343418_00006.jpg"
] | 1 |
[
63,
513,
532,
572
] |
|
PMC4587850_00004.jpg
|
text
|
What is the ascending order of conflict management modes according to Schwarz?
|
Avoiding, Competing, Accommodating, Delegating, Compromising, Collaborating
|
[
"PMC3420751_00007.jpg",
"PMC4587850_00004.jpg",
"PMC4467233_00002.jpg"
] | 1 |
[
56,
88,
290,
159
] |
|
PMC3593001_00000.jpg
|
text
|
What is the main focus of the research discussed in the abstract?
|
The main focus is on infants' ability to reason about others' goals without knowing their preferences.
|
[] | -1 |
[
40,
414,
281,
521
] |
|
PMC3205819_00001.jpg
|
text
|
What is the aim of the study?
|
To examine the relationships among bent posture, height loss, and stroke risk based on the hypothesis.
|
[] | -1 |
[
63,
224,
292,
391
] |
|
PMC4758391_00008.jpg
|
text
|
What is the main focus of the research-based curriculum?
|
Involves assignments that are atypical for a standard laboratory course.
|
[
"PMC3657071_00001.jpg",
"PMC5327658_00001.jpg",
"PMC5450437_00002.jpg"
] | -1 |
[
59,
491,
314,
741
] |
|
PMC6054020_00013.jpg
|
text
|
What happens to resident households' income when property valuations decrease?
|
Resident households experience a loss in income.
|
[
"PMC6001347_00004.jpg",
"PMC6054020_00013.jpg",
"PMC5585738_00023.jpg"
] | 1 |
[
45,
57,
391,
79
] |
|
PMC5845041_00003.jpg
|
text
|
What is the purpose of histological counting of the number of follicles at each stage?
|
To determine whether certain molecules exert effects on follicle development.
|
[
"PMC2794297_00001.jpg",
"PMC5845041_00003.jpg",
"PMC3866531_00002.jpg"
] | 1 |
[
51,
269,
289,
404
] |
|
PMC5410135_00006.jpg
|
text
|
What is the adjusted OR for the metabolic syndrome and combined APOA1/APOC3 genotypes according to quartile classification of food group intakes?
|
95% CI
|
[
"PMC3545982_00002.jpg",
"PMC5515964_00007.jpg",
"PMC5568207_00005.jpg"
] | -1 |
[
22,
341,
573,
374
] |
|
PMC4484382_00002.jpg
|
text
|
What was the main focus of the studies included in the review?
|
The main focus of the studies included in the review was to investigate the cost-effectiveness of mass media campaigns in smoking prevention and cessation.
|
[
"PMC3736151_00006.jpg",
"PMC5748411_00011.jpg",
"PMC3514321_00000.jpg"
] | -1 |
[
42,
189,
288,
211
] |
|
PMC3293201_00002.jpg
|
text
|
What is the main focus of the study?
|
The study focuses on the movement of wolves in relation to seismic lines.
|
[] | -1 |
[
314,
413,
551,
620
] |
|
PMC5872363_00006.jpg
|
text
|
What is the relationship between CIMT and atherosclerosis?
|
CIMT can be considered an excellent non-invasive measure of generalized atherosclerosis.
|
[
"PMC3522355_00002.jpg",
"PMC5033815_00009.jpg",
"PMC4485696_00003.jpg"
] | -1 |
[
76,
642,
520,
762
] |
|
PMC6052332_00002.jpg
|
text
|
How many isolates were in Clade I?
|
17
|
[
"PMC4361717_00005.jpg",
"PMC4361717_00002.jpg",
"PMC3658828_00005.jpg"
] | -1 |
[
51,
635,
572,
662
] |
|
PMC5497644_00001.jpg
|
text
|
How much blood was collected from participants?
|
3 ml
|
[
"PMC5427702_00002.jpg",
"PMC5497644_00001.jpg",
"PMC4139605_00002.jpg"
] | 1 |
[
50,
600,
290,
648
] |
|
PMC5382517_00009.jpg
|
text
|
What is the main focus of the study mentioned in the red bounding box?
|
The study focuses on the usefulness of OF testing for confirmation of M. hyo in clinical PRDC.
|
[] | -1 |
[
56,
566,
290,
733
] |
|
PMC5312624_00000.jpg
|
text
|
Under what license is this article distributed?
|
Creative Commons License
|
[] | -1 |
[
62,
706,
552,
737
] |
|
PMC5437202_00001.jpg
|
text
|
What is the purpose of the School of POWHER?
|
To train comadronas in basic prenatal care and sale labor
|
[
"PMC4978636_00001.jpg",
"PMC5533825_00006.jpg",
"PMC5437202_00001.jpg"
] | 2 |
[
306,
175,
552,
302
] |
|
PMC5033134_00003.jpg
|
text
|
What is the average phenotype for C. eriphyle?
|
51.8 ± 7.0% absorptivity and 0.63 ± 0.18 mm thoracic setal length
|
[
"PMC5316474_00016.jpg",
"PMC5104812_00005.jpg",
"PMC5033134_00003.jpg"
] | 2 |
[
311,
534,
547,
632
] |
|
PMC3744851_00001.jpg
|
text
|
What is the purpose of the RT-PCR analysis?
|
To determine the expression of specific genes in the plant samples.
|
[] | -1 |
[
45,
671,
291,
715
] |